View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12722_low_27 (Length: 223)
Name: NF12722_low_27
Description: NF12722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12722_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 2e-66; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 18 - 157
Target Start/End: Complemental strand, 46310542 - 46310403
Alignment:
| Q |
18 |
cagcagtatcattgaagggctgttgaagaaaaagtactactactaccctaggctgaaactagtctaaagataaccaccgatgcggctgtagagtaaccat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46310542 |
cagcagtatcattgaagggctgttgaagaaaaagtactactactaccctaggctgaaactagtctaaagataaccacggatgcggctgtagagtaaccat |
46310443 |
T |
 |
| Q |
118 |
taaaggatttcatttgttgagattgcagaatggtgattgt |
157 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
46310442 |
taaaggatttcctttgttgagattgcagaatgttgattgt |
46310403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 120 - 207
Target Start/End: Complemental strand, 46309701 - 46309616
Alignment:
| Q |
120 |
aaggatttcatttgttgagattgcagaatggtgattgtgttgaaatttacttcgtgtgttgctaatatatattttcttccaagttcat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46309701 |
aaggatttcatttgttgagattgcagaatggtgattgtgttgaaatttacttc--gtgttgctaatatatattttcttccaagttcat |
46309616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University