View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12722_low_29 (Length: 216)
Name: NF12722_low_29
Description: NF12722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12722_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 26776489 - 26776292
Alignment:
| Q |
1 |
gagtctctaagaccttgatagagcacactccaaggtctccagccaacaccaaaagaccgaaagcttcaccttaattagtatcttatcattattatgttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26776489 |
gagtctctaagaccttgatagagcacactccaaggtctccagccaacacctaaagactgaaagcttcaccttaattagtatcttatcattattatgttat |
26776390 |
T |
|
| Q |
101 |
taacagccatgcatgtaagttgtaaataataacaatctaaaaacaaat----ttccaaagcaaagcaaagcaaagataaacagacctgtgttcatcttct |
196 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||| | | |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26776389 |
taacagccatgaatgtaagttgtaaataacaacaatctaaaaacaattaagttaccaaagcaaagc-----aaagataaacagacctgtgttcatcttct |
26776295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University