View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12722_low_8 (Length: 343)
Name: NF12722_low_8
Description: NF12722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12722_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 52; Significance: 9e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 128 - 203
Target Start/End: Original strand, 52302868 - 52302943
Alignment:
| Q |
128 |
caaaatatgaaataagaggaagattaggagtgtgttttccttgtgatagtgcagttatgttactgttactaacttg |
203 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
52302868 |
caaaatattaaataagtggaagattaggagtgtgtcttccttgtgatagtgcagttatgttgttgttgctaacttg |
52302943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 3176028 - 3176075
Alignment:
| Q |
1 |
gttgttgttcatcaaaatcgtaacactcgcaagtaatgaaataaaatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3176028 |
gttgttgttcatcaaaatcgtaacactcgcaagtaatgaaataaaatc |
3176075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University