View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12723_high_13 (Length: 281)
Name: NF12723_high_13
Description: NF12723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12723_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 6e-80; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 17 - 220
Target Start/End: Complemental strand, 43129564 - 43129359
Alignment:
| Q |
17 |
aatttgttcggtctcaaggaacaattttaaaatcaaatacaattatcaaattttgagagtattgatagtaannnnnnnncct--tctttctggtgacaga |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |||||||||||||| |
|
|
| T |
43129564 |
aatttgttcggtctcaaggaacaattttaaaatcaaatacaattatcaaattttgagagtattgatagtaattttattttttattttttctggtgacaga |
43129465 |
T |
 |
| Q |
115 |
aacgatgactaaacaaggaggtgatgatcatggttgcagctatcagaatcgaagtaacaaagacaacaacaaaaatgctgtccatgaaggctcaacgaag |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43129464 |
aacgatgactaaacaaggaggtgatgatcatggttgcagctatcagaatgaaagtaacaaagacaacaacaaaaatgctgtccatgaaggctcaacgaag |
43129365 |
T |
 |
| Q |
215 |
gctcag |
220 |
Q |
| |
|
|||||| |
|
|
| T |
43129364 |
gctcag |
43129359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 238 - 270
Target Start/End: Complemental strand, 43129341 - 43129309
Alignment:
| Q |
238 |
gggctcaaaagggaagaatggtggctcagtgaa |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43129341 |
gggctcaaaagggaagaatggtggctcagtgaa |
43129309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University