View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12723_high_24 (Length: 219)
Name: NF12723_high_24
Description: NF12723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12723_high_24 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 13212921 - 13213139
Alignment:
| Q |
1 |
agcacttccgctaccgccgtcgtcttttccttctcctccggtgggagtgttgttgccgtcttcgttgtttcgttctcttttttggcctcggcttaagctc |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13212921 |
agcacttccgctaccaccgtcgtcttttccttctcctccggtgggagtgttgttgccgtcttcgttgtttcgttctcttttttggcctcggcttaagctc |
13213020 |
T |
 |
| Q |
101 |
ccattgccactttgttgttcctcttcattggtttggtggttggtgtgaaattgatggtgaggatgaagatggaggtctctagtgagaaatggaggaggaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
13213021 |
ccattgccactttgttgttcctcttcattggtttggtggttggtgtgaaattgatggtgaggatgaagatgaaggtctctagtgagaaatggaggtggaa |
13213120 |
T |
 |
| Q |
201 |
gaggacgaccttgtgctac |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
13213121 |
gaggacgaccttgtgctac |
13213139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University