View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12723_low_22 (Length: 243)
Name: NF12723_low_22
Description: NF12723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12723_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 9 - 224
Target Start/End: Original strand, 47782353 - 47782568
Alignment:
| Q |
9 |
agcagagaagtgagaagagttttgtacagtagtttattcgccatgatgcggcatggttcatgtttctatcccgtcgctgcttctaaagaagagactcccc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47782353 |
agcagagaagtgagaagagttttgtacagtagtttattcgccatgatgtggcatggttcgtgtttctatcccgtcgctgcttctaaagaagaggctcccc |
47782452 |
T |
|
| Q |
109 |
attttgtaagatgaagaaagaatatgtacagtatgggcgagagcaaagagatgatcttctcgccaattgtggttggtctagttggtaaggagcaaactca |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
47782453 |
tttttgtaagatgaagaaagaatgtgtacagtatgggcgagagcaaagagatgatcttctcgccaattgtgattggtctagttggtaaggagcaaactca |
47782552 |
T |
|
| Q |
209 |
gaccccacaaaggtgt |
224 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
47782553 |
gaccccacaaaggtgt |
47782568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University