View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12723_low_27 (Length: 219)

Name: NF12723_low_27
Description: NF12723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12723_low_27
NF12723_low_27
[»] chr8 (1 HSPs)
chr8 (1-219)||(13212921-13213139)


Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 13212921 - 13213139
Alignment:
1 agcacttccgctaccgccgtcgtcttttccttctcctccggtgggagtgttgttgccgtcttcgttgtttcgttctcttttttggcctcggcttaagctc 100  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13212921 agcacttccgctaccaccgtcgtcttttccttctcctccggtgggagtgttgttgccgtcttcgttgtttcgttctcttttttggcctcggcttaagctc 13213020  T
101 ccattgccactttgttgttcctcttcattggtttggtggttggtgtgaaattgatggtgaggatgaagatggaggtctctagtgagaaatggaggaggaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||    
13213021 ccattgccactttgttgttcctcttcattggtttggtggttggtgtgaaattgatggtgaggatgaagatgaaggtctctagtgagaaatggaggtggaa 13213120  T
201 gaggacgaccttgtgctac 219  Q
    |||||||||||||||||||    
13213121 gaggacgaccttgtgctac 13213139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University