View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12725_low_6 (Length: 215)
Name: NF12725_low_6
Description: NF12725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12725_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 9 - 197
Target Start/End: Original strand, 13110678 - 13110871
Alignment:
| Q |
9 |
aggagcacagacaaaccagaactttcattcaaaaaatttaatgtgaaattaattctcaaattcaagaatataagaataaatgagaatatgtctaaatgta |
108 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13110678 |
aggatcacaaacaaaccagaactttcattcaaaatatttaatgtgaaattaattctcaaattcaagaatataagaataaatgagaatatgtctaaatgta |
13110777 |
T |
 |
| Q |
109 |
aataattgag-----ttttctaaatgagaatatgtctactatgtaaataattcaccattgtttatcaattaaaatgattctttatgaacttttt |
197 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13110778 |
aataattgagtttttttttctaaatgagaatatgtctactatgtaaataattcaccattgtttatcaattaaaatgattctttatgaacttttt |
13110871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University