View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12726_low_12 (Length: 207)
Name: NF12726_low_12
Description: NF12726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12726_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 20 - 185
Target Start/End: Original strand, 17568971 - 17569137
Alignment:
| Q |
20 |
agaattaagaaaatccgaaaaggtttttggtttatttggcattccacaatttttgaagagattaagcttgtctcttggaggtggagtttaagtaggttga |
119 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| ||||||||||||||| ||| |
|
|
| T |
17568971 |
agaagtaagaaaatccgaaaaggtttttggtttatttggcattccccaatttttgaagagattaagcttgtgtcttggagttggagtttaagtaggctga |
17569070 |
T |
 |
| Q |
120 |
agattcctacatgta-nnnnnnncccgaatggagttgggatcctgcagattgtttgaatatggggtg |
185 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17569071 |
agattcctacatgtattttttttcccgaatgaagttgggatcctgcagattgtttgaatatggggtg |
17569137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University