View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12726_low_5 (Length: 314)
Name: NF12726_low_5
Description: NF12726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12726_low_5 |
 | |
|
| [»] scaffold0360 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 20 - 298
Target Start/End: Original strand, 5840556 - 5840837
Alignment:
| Q |
20 |
agggtaacttatgtgatctttgttcttgaggatggtggtttttgtagtggctttgttttctacttgctgctgcatttttgttttt-cttctgcccgtgtt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
5840556 |
agggtaacttatgtgatctttgttcttgaggatggtggtttttgtagtggctttgttttctacttgctgctgcatttttgttttttctgctgcccgtgtt |
5840655 |
T |
|
| Q |
119 |
gccttctttgcgctaggttgttgtttaagcggtttggccttgattggcttttttgtattgttccccagctcttttactgcacttctgctgc-ggggggct |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5840656 |
gccttctttgcgctaggttgttgtttaagcggtttggccttgattggcttttttgtattgttccccagctcttttactgcacttctgctgcgggggggct |
5840755 |
T |
|
| Q |
218 |
tttgataaataaatattgctttttc-nnnnnnnnnnnnnnnntgtatgtctttgtttaaagtttttcaattaggtcattgtc |
298 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5840756 |
tttgataaataaatattgttttttcaaaaaaaataaaaaaaatgtatgtctttgtttaaagtttttcaattaggtcattgtc |
5840837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 133 - 304
Target Start/End: Original strand, 5846813 - 5846989
Alignment:
| Q |
133 |
aggttgttgtttaagcggtttggccttgattggcttttttgtattgttccccagct------cttttactgcacttctgctgcggggggcttttgataaa |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| || ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5846813 |
aggttgttgtttaagcggtttggccttgattcgcttttttgtattgttccccatctcttttacttttactgcacttctgctgcgggggggctttgataaa |
5846912 |
T |
|
| Q |
227 |
taaatattgctttttcnnnnnnnnnnnnnnnntgtatgtctttgtttaaagtttttcaattaggtcattgtccctatg |
304 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5846913 |
taaatattgctttttc-aaaaaaaaaaaaaaatgtctgtctttgtttaaagtttttcaattaggtcattgtctctatg |
5846989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 98; Significance: 3e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 37 - 231
Target Start/End: Complemental strand, 6350053 - 6349858
Alignment:
| Q |
37 |
ctttgttcttgaggatggtggtttttgtagtggctttgttttctacttgctgctgcatttttgtttttcttctgcc--cgtgttgccttctttgcgctag |
134 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||| |||||||||| ||||||||||||| ||||| |||||||||||| ||||| || |
|
|
| T |
6350053 |
ctttgttcttgaggatggtggtttctgtagtggcttagttttctatttgctgctgcttttttgtttttctgctgcctgtgtgttgccttctatgcgccag |
6349954 |
T |
|
| Q |
135 |
gttgttgtttaagcggtttggccttgattggcttttttgtattgttccccagctcttttactgcacttctgctgcggggggcttttgataaataaat |
231 |
Q |
| |
|
||||||||||||| |||||||||||||| ||| ||| ||||| ||||| | ||||||| |||||||||||||| |||| |||||||| ||||||| |
|
|
| T |
6349953 |
gttgttgtttaaggggtttggccttgataggc-tttgtgtatggttccataactctttttatgcacttctgctgcaggggacttttgattaataaat |
6349858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0360 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: scaffold0360
Description:
Target: scaffold0360; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 69
Target Start/End: Complemental strand, 4649 - 4600
Alignment:
| Q |
20 |
agggtaacttatgtgatctttgttcttgaggatggtggtttttgtagtgg |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4649 |
agggtaacttatgtgatctttgttcttgaggatggtggtttttgtagtgg |
4600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University