View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12727_high_8 (Length: 220)
Name: NF12727_high_8
Description: NF12727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12727_high_8 |
 | |
|
| [»] scaffold0041 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0041 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 18 - 128
Target Start/End: Original strand, 111794 - 111904
Alignment:
| Q |
18 |
gacaagtgatgaagggaaggatttggtgacggtaaaaggaacgatagatgcaaaggaaattgtaccatatctggcggagaagctgaagcggaatgtggat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
111794 |
gacaagtgatgaagggaaggatttggtgacggtaaaaggaacgatagatgcaaaggaaattgtaccatatctggcggagaagctgaagcggaatgtggat |
111893 |
T |
|
| Q |
118 |
gtggttcaacc |
128 |
Q |
| |
|
||||||||||| |
|
|
| T |
111894 |
gtggttcaacc |
111904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 18 - 128
Target Start/End: Complemental strand, 41143517 - 41143407
Alignment:
| Q |
18 |
gacaagtgatgaagggaaggatttggtgacggtaaaaggaacgatagatgcaaaggaaattgtaccatatctggcggagaagctgaagcggaatgtggat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41143517 |
gacaagtgatgaagggaaggatttggtgacggtaaaaggaacgatagatgcaaaggaaattgtaccatatctggcggagaagctgaagcggaatgtggat |
41143418 |
T |
|
| Q |
118 |
gtggttcaacc |
128 |
Q |
| |
|
||||||||||| |
|
|
| T |
41143417 |
gtggttcaacc |
41143407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 60 - 128
Target Start/End: Original strand, 1654811 - 1654879
Alignment:
| Q |
60 |
gatagatgcaaaggaaattgtaccatatctggcggagaagctgaagcggaatgtggatgtggttcaacc |
128 |
Q |
| |
|
||||||||| ||||||||||||||| || ||||||||||| ||| || |||||| | ||||||||||| |
|
|
| T |
1654811 |
gatagatgcgaaggaaattgtaccagatatggcggagaaggtgatacgaaatgtgaaggtggttcaacc |
1654879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University