View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12727_low_5 (Length: 315)
Name: NF12727_low_5
Description: NF12727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12727_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 19 - 308
Target Start/End: Original strand, 1594587 - 1594876
Alignment:
| Q |
19 |
agaagaggatagagataggagaaggaacaacaatgatgacagtagaagagagaaaggagttaatgttctttaaagatgagacaaaatttcaaatgggaga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1594587 |
agaagaggatagagataggagaaggaacaacaatgatgacagtagaagagagaaaggagttaatgttctttaaagatgagacaaaatttcaaatgggaga |
1594686 |
T |
|
| Q |
119 |
acttcttagagcttctgctgaggcattaggtcatggaattatgggaaatagttataaggcaatgttgaataatggacctaccattgttgtaaagaggtta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1594687 |
acttcttagagcttctgctgaggcattaggtcatggaattatgggaaatagttataaggcaatgttgaataatggacctaccattgttgtaaagaggtta |
1594786 |
T |
|
| Q |
219 |
agggacttgaaaccattcactaaggaggaatttgcaaagatagtgaaaatgattgctgatcttagacaccctaatttattgcctttgctt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1594787 |
agggacttgaaaccattcactaaggaggaatttgcaaagatagtgaaaatgattgctgatcttagacaccctaatttattgcctttgctt |
1594876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University