View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12728_high_23 (Length: 261)
Name: NF12728_high_23
Description: NF12728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12728_high_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 18 - 251
Target Start/End: Complemental strand, 42449823 - 42449590
Alignment:
| Q |
18 |
aaatctacagcaattttttatgttattttattcttaaacccctcaaaacttatgcctttcacaactctatttatttagtttttaaatatgtccaatgaca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42449823 |
aaatctacagcaattttttatgttattttattcttaaacccctcaaaacgtatgcctttcacaactctatttatttagtttttaaatatgtccaatgaca |
42449724 |
T |
|
| Q |
118 |
gccagttatgcaagattgtaatgtaattaaaatgaaaatatttggataaaatagcatggatgtaacatggttttcgcggtggctacgtcgcgagaaaaat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42449723 |
gccagttatgcaagattgtaatgtaattaaaatgaaaatatttggataaaatagcgtggatgtaacatggttttcgcggtggctacatcgcgagaaaaat |
42449624 |
T |
|
| Q |
218 |
gcgttgcgcgagagctgaattcaactgccctatg |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42449623 |
gcgttgcgcgagagctgaattcaactgccctatg |
42449590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University