View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12728_low_18 (Length: 298)
Name: NF12728_low_18
Description: NF12728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12728_low_18 |
 | |
|
| [»] scaffold0620 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 116; Significance: 5e-59; HSPs: 10)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 56 - 171
Target Start/End: Complemental strand, 34100771 - 34100656
Alignment:
| Q |
56 |
atatcagaatacaacatcttcgccaccgacttctgtgggtatgcaaattaatattaaaaagaactcaaatttagacaaagaaaataataaaaattgtttg |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34100771 |
atatcagaatacaacatcttcgccaccgacttctgtgggtatgcaaattaatattaaaaagaactcaaatttagacaaagaaaataataaaaattgtttg |
34100672 |
T |
|
| Q |
156 |
aatctaaagcattgtt |
171 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
34100671 |
aatctaaagcattgtt |
34100656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 190 - 236
Target Start/End: Complemental strand, 34149561 - 34149515
Alignment:
| Q |
190 |
aaacttgccttggattttgcccaagatctccttttgggatatctcct |
236 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
34149561 |
aaacttgccttggattttgccaaagatctccttttggggtatctcct |
34149515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 190 - 236
Target Start/End: Complemental strand, 34162177 - 34162131
Alignment:
| Q |
190 |
aaacttgccttggattttgcccaagatctccttttgggatatctcct |
236 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
34162177 |
aaacttgccttggattttgccaaagatctccttttggggtatctcct |
34162131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 190 - 271
Target Start/End: Complemental strand, 34115363 - 34115282
Alignment:
| Q |
190 |
aaacttgccttggattttgcccaagatctccttttgggatatctccttctttcggagtatctcataaaattgattcattcat |
271 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||| ||| | || | || |||||||||| |||||||| | |||||| |
|
|
| T |
34115363 |
aaacttgccttggattttgccaaagatctccttctggggtatttactccgtttggagtatctccaaaaattgaatgattcat |
34115282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 190 - 234
Target Start/End: Complemental strand, 34169470 - 34169426
Alignment:
| Q |
190 |
aaacttgccttggattttgcccaagatctccttttgggatatctc |
234 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
34169470 |
aaacttaccttggattttgccaaagatctccttttggggtatctc |
34169426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 190 - 233
Target Start/End: Complemental strand, 34091637 - 34091594
Alignment:
| Q |
190 |
aaacttgccttggattttgcccaagatctccttttgggatatct |
233 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| || ||||| |
|
|
| T |
34091637 |
aaacttgccttggattttacccaagatctccttttcgggtatct |
34091594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 190 - 251
Target Start/End: Complemental strand, 34109362 - 34109301
Alignment:
| Q |
190 |
aaacttgccttggattttgcccaagatctccttttgggatatctccttctttcggagtatct |
251 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||| || ||||| || |||| || |||||| |
|
|
| T |
34109362 |
aaacttgccttagattttacccaagatctccttttcgggtatctactccttttggggtatct |
34109301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 192 - 233
Target Start/End: Complemental strand, 34119998 - 34119957
Alignment:
| Q |
192 |
acttgccttggattttgcccaagatctccttttgggatatct |
233 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| || ||||| |
|
|
| T |
34119998 |
acttgccttggattttacccaagatctcctttttgggtatct |
34119957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 192 - 224
Target Start/End: Complemental strand, 34147159 - 34147127
Alignment:
| Q |
192 |
acttgccttggattttgcccaagatctcctttt |
224 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
34147159 |
acttgccttggattttacccaagatctcctttt |
34147127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 192 - 224
Target Start/End: Complemental strand, 34159775 - 34159743
Alignment:
| Q |
192 |
acttgccttggattttgcccaagatctcctttt |
224 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
34159775 |
acttgccttggattttacccaagatctcctttt |
34159743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0620 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0620
Description:
Target: scaffold0620; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 233
Target Start/End: Complemental strand, 6976 - 6928
Alignment:
| Q |
185 |
caaagaaacttgccttggattttgcccaagatctccttttgggatatct |
233 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||| || ||||| |
|
|
| T |
6976 |
caaaaaaacttgccttggattttacccaagatctccttttcgggtatct |
6928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University