View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12728_low_20 (Length: 294)
Name: NF12728_low_20
Description: NF12728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12728_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 129 - 280
Target Start/End: Complemental strand, 49332674 - 49332523
Alignment:
| Q |
129 |
cttctaaaacaacttatattcatttatatgtatctttcattcattctctttagtggcaactggcaaatgatatttgtccggagaaatgtcatcaagaaag |
228 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49332674 |
cttctaaaacaacttatattcatttatttgtatctttcattcattctctttactggcaacttgcaaatgatatttgtccggagaaatgtcatcaagaaag |
49332575 |
T |
 |
| Q |
229 |
catcacaaagagaatgtgacaatgggtgttgctatatatcccacaagttacc |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49332574 |
catcacaaagagaatgtgacaatgggtgttgctatatatcccacaagttacc |
49332523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 19 - 104
Target Start/End: Complemental strand, 49332743 - 49332658
Alignment:
| Q |
19 |
catagataacttctttcactttttaagttttatgaggtgtggatgacttctttcgttggagcccaagaacttctaaaacaacttat |
104 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49332743 |
catagataacttctttcactttttaatttttatgaggtgtggataacttctttcgttggagcccaagaacttctaaaacaacttat |
49332658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University