View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12728_low_28 (Length: 240)
Name: NF12728_low_28
Description: NF12728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12728_low_28 |
 |  |
|
| [»] scaffold0586 (1 HSPs) |
 |  |  |
|
| [»] scaffold1033 (1 HSPs) |
 |  |  |
|
| [»] scaffold1029 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
| [»] scaffold0047 (1 HSPs) |
 |  |  |
|
| [»] scaffold0481 (1 HSPs) |
 |  |  |
|
| [»] scaffold0161 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 96; Significance: 3e-47; HSPs: 8)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 69 - 172
Target Start/End: Original strand, 4460236 - 4460339
Alignment:
| Q |
69 |
agtatgtgtttgttgtaccggtagaaataggaaaaaatgccgtttgcacaaaagctacaaaaggtagcttctttattttcacgtttaaaatgccttggga |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4460236 |
agtatgtgtttgttgtaccggtagaaataggaaaaaacgccgtttgcacaaaagctacaaaaggtagcttctttattttcacgttcaaaatgccttggga |
4460335 |
T |
 |
| Q |
169 |
cgtg |
172 |
Q |
| |
|
|||| |
|
|
| T |
4460336 |
cgtg |
4460339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 65 - 170
Target Start/End: Complemental strand, 17993587 - 17993482
Alignment:
| Q |
65 |
attaagtatgtgtttgttgtaccggtagaaataggaaaaaatgccgtttgcacaaaagctacaaaaggtagcttctttattttcacgtttaaaatgcctt |
164 |
Q |
| |
|
|||||| | |||||||||||| |||| ||||||| |||||| |||||||||||||||||| |||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
17993587 |
attaagaacgtgtttgttgtagcggtggaaatagaaaaaaacgccgtttgcacaaaagcttcaaaaggtagcttctttattttcacgttcaaaacgcctt |
17993488 |
T |
 |
| Q |
165 |
gggacg |
170 |
Q |
| |
|
|||||| |
|
|
| T |
17993487 |
gggacg |
17993482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 12343153 - 12343201
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12343153 |
aatgcttgtgtttctctctctttcacaagcattgtgacattgtgattgg |
12343201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 10521934 - 10521886
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
10521934 |
aatgcttgtgtttctctctctttcataagcattgtgacattgtgattgg |
10521886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 13043510 - 13043556
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgatt |
219 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| | ||||||| |
|
|
| T |
13043510 |
aatgcttgtgtttctctctctttcacaagcattgtgatattgtgatt |
13043556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 220
Target Start/End: Complemental strand, 551250 - 551203
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||| || |||||||| |
|
|
| T |
551250 |
aatgcttgtgtttctctctctttcacaaacattgtggcattgtgattg |
551203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 220
Target Start/End: Complemental strand, 24618686 - 24618639
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||| ||||| |||||||| |
|
|
| T |
24618686 |
aatgcttgtgtttctctctctttcataagcattatgacattgtgattg |
24618639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 217
Target Start/End: Original strand, 24587514 - 24587558
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtga |
217 |
Q |
| |
|
|||||||||| ||||| || ||||||||||||||||||| ||||| |
|
|
| T |
24587514 |
aatgcttgtgtttctcgctttttcacaagcattgtgacattgtga |
24587558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 64; Significance: 4e-28; HSPs: 22)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 69 - 172
Target Start/End: Complemental strand, 53791291 - 53791188
Alignment:
| Q |
69 |
agtatgtgtttgttgtaccggtagaaataggaaaaaatgccgtttgcacaaaagctacaaaaggtagcttctttattttcacgtttaaaatgccttggga |
168 |
Q |
| |
|
|||| ||||||||||| |||| ||||||| |||||| ||||||||||||||||||||||| |||||||||||||||||||| || ||||||||| |||| |
|
|
| T |
53791291 |
agtacgtgtttgttgtggcggtggaaatagaaaaaaacgccgtttgcacaaaagctacaaatggtagcttctttattttcactttcaaaatgcctcggga |
53791192 |
T |
 |
| Q |
169 |
cgtg |
172 |
Q |
| |
|
|||| |
|
|
| T |
53791191 |
cgtg |
53791188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 74 - 160
Target Start/End: Original strand, 44769853 - 44769941
Alignment:
| Q |
74 |
gtgtttgttgtaccggtagaaataggaaaaaatgc--cgtttgcacaaaagctacaaaaggtagcttctttattttcacgtttaaaatg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||| |||||| | |||||| ||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
44769853 |
gtgtttgttgtagcggtggaaatagaaaaaaaaacggcgtttgtacaaaagctacaaaaggtaacttctttattttcacgttcaaaatg |
44769941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 23444354 - 23444303
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23444354 |
aatgcttgtgtttctctctctttcacaagcattgtgacattgtgattggtca |
23444303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 47661895 - 47661946
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
47661895 |
aatgcttgtgtttctctctctttcacaagcattgtgacattgtgattggtca |
47661946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 6271755 - 6271803
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6271755 |
aatgcttgtgtttctctctctttcacaagcattgtgacattgtgattgg |
6271803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 50384190 - 50384142
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
50384190 |
aatgcttgtgtttctctctctttcacaagcattgtgacattgtgattgg |
50384142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 173 - 220
Target Start/End: Original strand, 42375063 - 42375110
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42375063 |
aatgcttgtgtttctctctctttcacaagcattgtgacattgtgattg |
42375110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 51265498 - 51265549
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
51265498 |
aatgcttgtgtttctctctctttcacaagcattgtgacattatgattggtca |
51265549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 40789232 - 40789280
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40789232 |
aatgtttgtgtttctctctctttcacaagcattgtgacattgtgattgg |
40789280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 52028602 - 52028650
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52028602 |
aatgtttgtgtttctctctctttcacaagcattgtgacattgtgattgg |
52028650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 173 - 220
Target Start/End: Complemental strand, 47404670 - 47404623
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
47404670 |
aatgcttgggtttctctctctttcacaagcattgtgacattgtgattg |
47404623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 173 - 220
Target Start/End: Complemental strand, 55090081 - 55090034
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
55090081 |
aatgcttgtgtctctctctctttcacaagcattgtgacattgtgattg |
55090034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 178 - 224
Target Start/End: Complemental strand, 31430541 - 31430495
Alignment:
| Q |
178 |
ttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
31430541 |
ttgtgtttctctctctttcataagcattgtgacattgtgattggtca |
31430495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 173 - 209
Target Start/End: Complemental strand, 30861859 - 30861823
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtga |
209 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30861859 |
aatgcttgtgtttctctctctttcacaagcattgtga |
30861823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 220
Target Start/End: Complemental strand, 25818458 - 25818411
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
|||| ||||| ||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
25818458 |
aatgattgtgtttctctctctttcacaatcattgtgacattgtgattg |
25818411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 28694008 - 28693957
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
|||| ||||| ||||||||||||||||| |||||||| | |||||||||||| |
|
|
| T |
28694008 |
aatgtttgtgtttctctctctttcacaaacattgtgatattgtgattggtca |
28693957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 177 - 224
Target Start/End: Original strand, 35682223 - 35682270
Alignment:
| Q |
177 |
cttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||| |||||| ||||| |
|
|
| T |
35682223 |
cttgtgtttctctatctttcacaagcattgtgacattgtgatcggtca |
35682270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 220
Target Start/End: Complemental strand, 45591495 - 45591448
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||| | |||||| |
|
|
| T |
45591495 |
aatgtttgtgtttctctctctttcacaagcattgtgacattatgattg |
45591448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 221
Target Start/End: Complemental strand, 24006144 - 24006107
Alignment:
| Q |
184 |
ttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
24006144 |
ttctctctctttcacaagcattgtgtcattgtgattgg |
24006107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 220
Target Start/End: Complemental strand, 26186087 - 26186054
Alignment:
| Q |
187 |
tctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
26186087 |
tctctctttcacaagcattgtgacattgtgattg |
26186054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 220
Target Start/End: Complemental strand, 49469982 - 49469946
Alignment:
| Q |
184 |
ttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
49469982 |
ttctctctctttcacaataattgtgacactgtgattg |
49469946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 53954663 - 53954711
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||||| ||| ||||| |||||||||||||||||||||| ||| ||||| |
|
|
| T |
53954663 |
aatgctagtgtttctcactctttcacaagcattgtgacattgtaattgg |
53954711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 61; Significance: 3e-26; HSPs: 15)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 74 - 170
Target Start/End: Original strand, 22489734 - 22489830
Alignment:
| Q |
74 |
gtgtttgttgtaccggtagaaataggaaaaaatgccgtttgcacaaaagctacaaaaggtagcttctttattttcacgtttaaaatgccttgggacg |
170 |
Q |
| |
|
||||||||||| |||| ||||||| |||||| ||||||||||||||||||| ||||||||||||||||||||||| ||| ||||||||| |||||| |
|
|
| T |
22489734 |
gtgtttgttgtggcggtggaaatagaaaaaaacgccgtttgcacaaaagctagaaaaggtagcttctttattttcatgttcaaaatgcctcgggacg |
22489830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 30476559 - 30476511
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30476559 |
aatgcttgtgtttctctctctttcacaagcattgtgacattgtgattgg |
30476511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 33689229 - 33689277
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33689229 |
aatgcttgtgtttctctctctttcacaagcattgtgacattgtgattgg |
33689277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 47492132 - 47492084
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
47492132 |
aatgcttgtgtttctctctttttcacaagcattgtgacattgtgattgg |
47492084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 173 - 220
Target Start/End: Complemental strand, 29031799 - 29031752
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29031799 |
aatgtttgtgtttctctctctttcacaagcattgtgacattgtgattg |
29031752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 173 - 220
Target Start/End: Complemental strand, 43139794 - 43139747
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
43139794 |
aatgcttgtgtttctctctctttcacaagcattctgacattgtgattg |
43139747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 47677340 - 47677289
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
47677340 |
aatgtttgtgtttctctctctttcacaagcattgtgacattgtgatcggtca |
47677289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 1801531 - 1801483
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
1801531 |
aatgtttgtgtttctctctctttcacaagcattgtggcattgtgattgg |
1801483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 177 - 224
Target Start/End: Complemental strand, 30734483 - 30734436
Alignment:
| Q |
177 |
cttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||| |||||| ||||| |
|
|
| T |
30734483 |
cttgtgtttctctatctttcacaagcattgtgacattgtgatcggtca |
30734436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 220
Target Start/End: Complemental strand, 51046158 - 51046111
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||| | |||||| |
|
|
| T |
51046158 |
aatgcttgtgtttctctctctttcacaaacattgtgacattatgattg |
51046111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 36 - 69
Target Start/End: Original strand, 1261463 - 1261496
Alignment:
| Q |
36 |
attggtgtgcagcttttccattgtcttagattaa |
69 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
1261463 |
attggtgtgcagcttttgcattgtcttagattaa |
1261496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 220
Target Start/End: Complemental strand, 45103180 - 45103147
Alignment:
| Q |
187 |
tctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
45103180 |
tctctctttcacaagcattgtgacattgtgattg |
45103147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 118 - 150
Target Start/End: Original strand, 19884717 - 19884749
Alignment:
| Q |
118 |
aaaagctacaaaaggtagcttctttattttcac |
150 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
19884717 |
aaaagctacaaaagttagcttctttattttcac |
19884749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 41753017 - 41753065
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||| ||||| |||| |||||||||||||||||||| || ||||||||| |
|
|
| T |
41753017 |
aatgtttgtgtttctttctctttcacaagcattgtggcattgtgattgg |
41753065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 220
Target Start/End: Original strand, 55223296 - 55223332
Alignment:
| Q |
184 |
ttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||| |
|
|
| T |
55223296 |
ttctctctctttcacaagcattgtgacattatgattg |
55223332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 56; Significance: 2e-23; HSPs: 14)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 69 - 168
Target Start/End: Complemental strand, 7395691 - 7395592
Alignment:
| Q |
69 |
agtatgtgtttgttgtaccggtagaaataggaaaaaatgccgtttgcacaaaagctacaaaaggtagcttctttattttcacgtttaaaatgccttggga |
168 |
Q |
| |
|
|||| |||||||||| |||| ||||||| |||||| ||||||||||||||||||||||| |||||||||||||||||||| || ||||||||| |||| |
|
|
| T |
7395691 |
agtacgtgtttgttgcggcggtggaaatagaaaaaaacgccgtttgcacaaaagctacaaatggtagcttctttattttcactttcaaaatgcctcggga |
7395592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 16514477 - 16514528
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
16514477 |
aatgcttgtgtttctctctctttcacaagcattgtgacattgtgattggtca |
16514528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 173 - 220
Target Start/End: Original strand, 2894016 - 2894063
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2894016 |
aatgcttgtatttctctctctttcacaagcattgtgacactgtgattg |
2894063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 173 - 220
Target Start/End: Complemental strand, 14229438 - 14229391
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14229438 |
aatgcttgtgtttctctctctttcacaagcattgtgacattgtgattg |
14229391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 2828637 - 2828685
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
2828637 |
aatgcttgtgtttctctctctttcagaagcattgtgacattgtgattgg |
2828685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 6722004 - 6722052
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
6722004 |
aatgcttgtgtttctctctctttcacaaacattgtgacattgtgattgg |
6722052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 15011333 - 15011381
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
15011333 |
aatgtttgtgtttctctctctttcacaagcattgtgacattgtgattgg |
15011381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 38933640 - 38933688
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
38933640 |
aatgcttgtgtttctctctctttcacaagcattgtgacattatgattgg |
38933688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 37762086 - 37762035
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||| |||| |||||||||||| |
|
|
| T |
37762086 |
aatgcttgtgtttctttctctttcacaagcattgcgacattgtgattggtca |
37762035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 37961759 - 37961810
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
37961759 |
aatgtttgtgtttctctctctttcacaagcattgtggcattgtgattggtca |
37961810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 6217309 - 6217261
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
6217309 |
aatgtttgtgtttctctctctttcacaagcattgtggcattgtgattgg |
6217261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 29508776 - 29508724
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgaca-ctgtgattggtca |
224 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
29508776 |
aatgcttgtgtttctctctctttcacaagcattgtggcatttgtgattggtca |
29508724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 14470677 - 14470626
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
14470677 |
aatgtttgtgtttctctctctttcacaagcattgcaacattgtgattggtca |
14470626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 217
Target Start/End: Complemental strand, 29925655 - 29925611
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtga |
217 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||| ||||| ||||| |
|
|
| T |
29925655 |
aatgtttgtgtttctctctctttcacaagcattctgacattgtga |
29925611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 6e-21; HSPs: 24)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 69 - 168
Target Start/End: Original strand, 45529506 - 45529605
Alignment:
| Q |
69 |
agtatgtgtttgttgtaccggtagaaataggaaaaaatgccgtttgcacaaaagctacaaaaggtagcttctttattttcacgtttaaaatgccttggga |
168 |
Q |
| |
|
|||| ||||||||||| |||| ||||||| |||||| ||||||||||||||||||| ||| | |||||||||||||||||| || ||||||||| |||| |
|
|
| T |
45529506 |
agtacgtgtttgttgtggcggtggaaatagaaaaaaacgccgtttgcacaaaagctataaatgttagcttctttattttcactttcaaaatgcctcggga |
45529605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 173 - 227
Target Start/End: Complemental strand, 29179682 - 29179628
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattggtcagtg |
227 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29179682 |
aatgcttgtgtttctctctctttcacaagcattgtgacattgtgattggtcagtg |
29179628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 17127649 - 17127598
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17127649 |
aatgcttgtgtttctctctctttcacaagcattgtgacattgtgattggtca |
17127598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 48994002 - 48993951
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
48994002 |
aatgcttgtgtttctctctctttcacaagcattgtgacattgtgattggtca |
48993951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 741587 - 741539
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
741587 |
aatgcttgtgtttctctctctttcacaagcattgtgacattgtgattgg |
741539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 32540833 - 32540785
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32540833 |
aatgcttgtgtttctctctctttcacaagcattgtgacattgtgattgg |
32540785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 5995422 - 5995473
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
5995422 |
aatgcttgtgtttctctctctttcacaagcattgtggcattgtgattggtca |
5995473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 29371421 - 29371472
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29371421 |
aatgtttgtgtttctctctctttcacaagcattgtgacattgtgattggtca |
29371472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 174 - 220
Target Start/End: Complemental strand, 1819573 - 1819527
Alignment:
| Q |
174 |
atgcttgtgcttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1819573 |
atgcttgtgtttctctctctttcacaagcattgtgacattgtgattg |
1819527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 15220864 - 15220912
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
15220864 |
aatgcttgtgtttctctctctttcacaagcattgtgagattgtgattgg |
15220912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 37155099 - 37155147
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
37155099 |
aatgcttgtgtttctctctctttcacaagtattgtgacattgtgattgg |
37155147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 46334031 - 46333983
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46334031 |
aatgcttgtgtttttctctctttcacaagcattgtgacattgtgattgg |
46333983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 173 - 220
Target Start/End: Complemental strand, 1091629 - 1091582
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1091629 |
aatgtttgtgtttctctctctttcacaagcattgtgacattgtgattg |
1091582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 173 - 220
Target Start/End: Original strand, 4609049 - 4609096
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4609049 |
aatgtttgtgtttctctctctttcacaagcattgtgacattgtgattg |
4609096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 34062262 - 34062313
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
||||||| || ||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
34062262 |
aatgcttatgtttctctctctttcacaaacattgtgacattgtgattggtca |
34062313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 173 - 220
Target Start/End: Original strand, 45728340 - 45728387
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
45728340 |
aatgcttgtgtttctctctctttcacaagcattatgacattgtgattg |
45728387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 220
Target Start/End: Complemental strand, 8337936 - 8337889
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
|||| ||||| ||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
8337936 |
aatgtttgtgtttctctctctttcacaaacattgtgacattgtgattg |
8337889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 220
Target Start/End: Original strand, 9157363 - 9157410
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||| | |||||||| |
|
|
| T |
9157363 |
aatgcttgtgtttctctctctttctcaagcattgtgatattgtgattg |
9157410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 178 - 221
Target Start/End: Complemental strand, 28928859 - 28928816
Alignment:
| Q |
178 |
ttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
28928859 |
ttgtgtttctctctctttcacaagcactgtgacattgtgattgg |
28928816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 220
Target Start/End: Original strand, 33219626 - 33219673
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
|||||||||| || ||||||||||||||||||| ||||| |||||||| |
|
|
| T |
33219626 |
aatgcttgtgtttttctctctttcacaagcattatgacattgtgattg |
33219673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 208
Target Start/End: Complemental strand, 44706869 - 44706834
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtg |
208 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44706869 |
aatgcttgtgtttctctctctttcacaagcattgtg |
44706834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 220
Target Start/End: Original strand, 47303448 - 47303495
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
|||| ||||| ||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
47303448 |
aatgtttgtgtttctctctctttcacaaacattgtgacattgtgattg |
47303495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 48498468 - 48498519
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||| || ||| |||||||||||| |
|
|
| T |
48498468 |
aatgtttgtgtttctctctctttcacaagcatggtaacattgtgattggtca |
48498519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 221
Target Start/End: Complemental strand, 38674576 - 38674542
Alignment:
| Q |
187 |
tctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38674576 |
tctctctttcacaagcattgtgacattgtgattgg |
38674542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 4e-16; HSPs: 12)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 5033214 - 5033265
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5033214 |
aatgcttgtgtttctctctctttcacaagcattgtgacattgtgattggtca |
5033265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 33841676 - 33841625
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33841676 |
aatgcttgtgtttctctctctttcacaagcattgtgacaatgtgattggtca |
33841625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 35441054 - 35441003
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35441054 |
aatgcttgtgtttctctctctttcacaagcattgtgacattgtgattggtca |
35441003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 172 - 220
Target Start/End: Original strand, 34229693 - 34229741
Alignment:
| Q |
172 |
gaatgcttgtgcttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| | |||||||| |
|
|
| T |
34229693 |
gaatgcttgtgtttctctctctttcacaagcattgtgatattgtgattg |
34229741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 173 - 220
Target Start/End: Complemental strand, 8243473 - 8243426
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| || |||||||| |
|
|
| T |
8243473 |
aatgcttgtgtttctctctctttcacaagcattgtggcattgtgattg |
8243426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 8796475 - 8796526
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||| | |||||||||| |
|
|
| T |
8796475 |
aatgcttgtgtttctctatctttcacaagcattgtgacattttgattggtca |
8796526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 10086810 - 10086861
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
|||| ||||| ||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
10086810 |
aatgtttgtgtttctctctctttcacaaacattgtgacattgtgattggtca |
10086861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 173 - 209
Target Start/End: Complemental strand, 34541888 - 34541852
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtga |
209 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
34541888 |
aatgcttgtgtttctctctctttcacaagcattgtga |
34541852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 211
Target Start/End: Original strand, 6296658 - 6296696
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgaca |
211 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
6296658 |
aatgcttgtgtttctctctctttcacaagtattgtgaca |
6296696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 221
Target Start/End: Original strand, 31159915 - 31159952
Alignment:
| Q |
184 |
ttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
31159915 |
ttctctctctttcacaagcattgtgacattatgattgg |
31159952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 5667150 - 5667198
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||| ||| ||||| |
|
|
| T |
5667150 |
aatgcttgtatttctctctctttcacaagcattatgacattgtaattgg |
5667198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 220
Target Start/End: Complemental strand, 35031688 - 35031652
Alignment:
| Q |
184 |
ttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
35031688 |
ttctctctctttcacaagcattgcgacattgtgattg |
35031652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 4e-16; HSPs: 13)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 3899892 - 3899943
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3899892 |
aatgcttgtgtttctctctctttcacaagcattgtgacattgtgattggtca |
3899943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 16971197 - 16971248
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
16971197 |
aatgcttgtgtttctctctctttcacaagcattgtgacattgtgattggtca |
16971248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 2953243 - 2953291
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2953243 |
aatgcttgtgtttctctctctttcacaagcattgtgacattgtgattgg |
2953291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 29699420 - 29699468
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29699420 |
aatgcttgtgtttctctctctttcacaagcattgtgacattgtgattgg |
29699468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 173 - 220
Target Start/End: Original strand, 16439191 - 16439238
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16439191 |
aatgcttgtgtttctctctctttcacaagcattgtgacattgtgattg |
16439238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 19655211 - 19655259
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19655211 |
aatgtttgtgtttctctctctttcacaagcattgtgacattgtgattgg |
19655259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 173 - 220
Target Start/End: Complemental strand, 2094022 - 2093975
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
2094022 |
aatgcttgtgtttctctctctttcacaagcattatgacattgtgattg |
2093975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 38134458 - 38134410
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||||||||| |||| |||||||||| |||||||||||| ||||||||| |
|
|
| T |
38134458 |
aatgcttgtgtttctttctctttcactagcattgtgacattgtgattgg |
38134410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 220
Target Start/End: Complemental strand, 3180145 - 3180098
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||| | |||||| |
|
|
| T |
3180145 |
aatgcttgtgtttctctctctttcacaaacattgtgacattatgattg |
3180098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 30117913 - 30117862
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
|||||||||| |||||||| ||||| || |||||||||| |||||||||||| |
|
|
| T |
30117913 |
aatgcttgtgtttctctctttttcataaacattgtgacattgtgattggtca |
30117862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 178 - 224
Target Start/End: Original strand, 16802502 - 16802548
Alignment:
| Q |
178 |
ttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||| | |||||||||| |
|
|
| T |
16802502 |
ttgtgtttctctctcttttacaagcattgtgacattctgattggtca |
16802548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 222
Target Start/End: Original strand, 19598385 - 19598433
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattggt |
222 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||| | |||||||| |
|
|
| T |
19598385 |
aatgcttgtgtttctctctctttcacaagcatt-tgacattatgattggt |
19598433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 220
Target Start/End: Original strand, 28818981 - 28819017
Alignment:
| Q |
184 |
ttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||| |
|
|
| T |
28818981 |
ttctctctctttcacaagcattgtgacattatgattg |
28819017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0586 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0586
Description:
Target: scaffold0586; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 7132 - 7084
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7132 |
aatgcttgtgtttctctctctttcacaagcattgtgacattgtgattgg |
7084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1033 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: scaffold1033
Description:
Target: scaffold1033; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 173 - 220
Target Start/End: Original strand, 2266 - 2313
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2266 |
aatgcttgtgtttctctctctttcacaagcattgtgacattgtgattg |
2313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1029 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: scaffold1029
Description:
Target: scaffold1029; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 173 - 220
Target Start/End: Original strand, 2266 - 2313
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2266 |
aatgcttgtgtttctctctctttcacaagcattgtgacattgtgattg |
2313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 49788 - 49737
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
49788 |
aatgcttgtgtttctctttctttcacaagcattgtgacattgtgattggtca |
49737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 12)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 11016922 - 11016973
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
11016922 |
aatgcttgtgtttctctctctttcacaaacattgtgacattgtgattggtca |
11016973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 15027595 - 15027646
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
15027595 |
aatgtttgtgtttctctctctttcacaagcattgtgacattgtgattggtca |
15027646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 4290598 - 4290646
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||||| ||| |||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
4290598 |
aatgctcgtgtttctctctctttcacaagaattgtgacattgtgattgg |
4290646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 7671996 - 7671948
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
7671996 |
aatgtttgtgtttctctctctttcacaagcattgtggcattgtgattgg |
7671948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 41018313 - 41018265
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
||||||| || ||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
41018313 |
aatgcttatgtttctctctctttcacaagcattgggacattgtgattgg |
41018265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 42628348 - 42628396
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
||||||| || ||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
42628348 |
aatgcttatgtttctctctctttcacaagcattgggacattgtgattgg |
42628396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 220
Target Start/End: Complemental strand, 27028878 - 27028831
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
|||| ||||| |||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
27028878 |
aatgtttgtgtttctctctctttcagaagcattgtgacattgtgattg |
27028831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 208
Target Start/End: Original strand, 38975858 - 38975893
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtg |
208 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38975858 |
aatgcttgtgtttctctctctttcacaagcattgtg |
38975893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 125 - 170
Target Start/End: Original strand, 15568864 - 15568909
Alignment:
| Q |
125 |
acaaaaggtagcttctttattttcacgtttaaaatgccttgggacg |
170 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||| |||| |||||| |
|
|
| T |
15568864 |
acaaaaggtaacttctttattttcacgttcaaaacgcctcgggacg |
15568909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 29053399 - 29053351
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||| | || ||||||||| |
|
|
| T |
29053399 |
aatgtttgtgtttctctctctttcacaagcattgaggcattgtgattgg |
29053351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 34854780 - 34854732
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||| ||||| |||| |||||||||||||||||||| || ||||||||| |
|
|
| T |
34854780 |
aatgtttgtgtttctatctctttcacaagcattgtggcattgtgattgg |
34854732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 220
Target Start/End: Complemental strand, 48000768 - 48000732
Alignment:
| Q |
184 |
ttctctctctttcacaagcattgtgacactgtgattg |
220 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||| |
|
|
| T |
48000768 |
ttctctctctttcacaagcattgtggcattgtgattg |
48000732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0047 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0047
Description:
Target: scaffold0047; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 63810 - 63858
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
63810 |
aatgtttgtgtttctctctctttcacaagcattgtgacattgtgattgg |
63858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0481 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0481
Description:
Target: scaffold0481; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 2972 - 2921
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattggtca |
224 |
Q |
| |
|
|||| ||||| ||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
2972 |
aatgtttgtgtttctctctctttcacaaacattgtgacattgtgattggtca |
2921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0161 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0161
Description:
Target: scaffold0161; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 27305 - 27257
Alignment:
| Q |
173 |
aatgcttgtgcttctctctctttcacaagcattgtgacactgtgattgg |
221 |
Q |
| |
|
||||||| || |||||||||||||||||| ||| ||||| ||||||||| |
|
|
| T |
27305 |
aatgcttctgtttctctctctttcacaagaattatgacattgtgattgg |
27257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University