View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12728_low_31 (Length: 222)
Name: NF12728_low_31
Description: NF12728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12728_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 10 - 203
Target Start/End: Original strand, 3887338 - 3887531
Alignment:
| Q |
10 |
gagtgagatgaaaaattgataaaaattaaggattgttctttgagagatcttcaatctaatttattgtaacctctttgtatcactcttttctttcctaaat |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| || |
|
|
| T |
3887338 |
gagtgacatgaaaaattgataaaaattaaggattgttcttcgagagatcttcaatctaatttattgtaacctctttgcatcactcttttctttcctagat |
3887437 |
T |
|
| Q |
110 |
gtatgtcatatttggccaaattgataaacaaacattggtgtgttgtttctctactctcttatccatgttctttgattatgcttgtggatttatt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3887438 |
gtatgtcatatttggccaaattgataaacaaacattggtgtgttgtttctctactctcttatccaggttctttgattatgcttgtggatttatt |
3887531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 134 - 195
Target Start/End: Original strand, 41163322 - 41163384
Alignment:
| Q |
134 |
taaacaaacattggtgtgttgtttct-ctactctcttatccatgttctttgattatgcttgtg |
195 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||||| | |||||||||||||||||| |
|
|
| T |
41163322 |
taaacaaatattggtgtgttgattcttctactctcttatctctaatctttgattatgcttgtg |
41163384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 197
Target Start/End: Complemental strand, 6628792 - 6628726
Alignment:
| Q |
132 |
gataaacaaacattggtgtgttgttt-ctctactctcttatccatgttctttgattatgcttgtgga |
197 |
Q |
| |
|
|||||||||| ||||||||||||||| || |||||||||| | || |||||||||||| ||||||| |
|
|
| T |
6628792 |
gataaacaaatattggtgtgttgtttcctttactctcttaactttgatctttgattatgtttgtgga |
6628726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University