View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1272_high_75 (Length: 246)
Name: NF1272_high_75
Description: NF1272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1272_high_75 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 11 - 246
Target Start/End: Complemental strand, 10929617 - 10929382
Alignment:
| Q |
11 |
caaaggggaaaaagtagaagtattgctggatttgggtatcttgccatttctaattacatccaccactacttgttgaaaaccatgggaccacttgtacgac |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| |
|
|
| T |
10929617 |
caaaggggaaaaagtagaagtattgctggatttgggtatcttgccatttctaattacatccaccactgcttgttgaaaaccatgggaccacttgtatgac |
10929518 |
T |
 |
| Q |
111 |
tcggcaattgaacttgcagattgacccgcactgttcaccaagccaaaatcagcaccagcccttgttagtactttgagacactcctcttgtttatattttg |
210 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10929517 |
tcggcaattgaacttgcagattgacctgcactgttcaccaagcaaaaatcagcaccagcccttgttagtactttgagacactcctcttgtttatattttg |
10929418 |
T |
 |
| Q |
211 |
cacaaaccatcaaagctgtgtcaccggagtctgttc |
246 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
10929417 |
cacaaatcatcaaagctgtgtcaccgcagtctgttc |
10929382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University