View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1272_high_80 (Length: 207)
Name: NF1272_high_80
Description: NF1272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1272_high_80 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 23 - 187
Target Start/End: Original strand, 6945747 - 6945911
Alignment:
| Q |
23 |
caaagagcacaggttacaacattaatcaatggtgtgtgaatccgacggtgtgtatgggcgatatagtgacctgaagtttcagaccagattgatgcattgg |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6945747 |
caaagagcacaggttacaacattaatcaatggtgtgtgaatccgagggtgtgtatgggcgatatagtgacctgaagtttcagaccagattgatgcattgg |
6945846 |
T |
|
| Q |
123 |
tgttttgtctcactgtttctgtattagttgtcttggaggtctcattttagttttctttaatggca |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6945847 |
tgttttgtctcactgtttctgtattagttgtcttggaggtctcattttagttttctttaatggca |
6945911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University