View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1272_low_42 (Length: 389)
Name: NF1272_low_42
Description: NF1272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1272_low_42 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 2e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 96 - 332
Target Start/End: Original strand, 2757457 - 2757691
Alignment:
| Q |
96 |
gaccgaatatgcacaccttgttgatatgtatgatctatttgccttccacttttttaatatagtagattatacgtgtttttctctaccnnnnnnnnnnnng |
195 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
2757457 |
gaccgaatatgcacaccttgttgatatatatgatctatttgccttccacttttttaatatagtagattatacgtgtttttctctacc--aaaaaaaaaag |
2757554 |
T |
|
| Q |
196 |
aatatacgtgnnnnnnnnaatgatattacacctcccttgttttcaactaaataaattgttttgtctattcccctnnnnnnnnnttgttttgtctattatc |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
2757555 |
aatatacgtgttttttttaatgatattacacctcccttgttttcaactaaataaattgttttgtctattcccctaaaaaaaaattgttttgtctgttatc |
2757654 |
T |
|
| Q |
296 |
ccttctctagttaacaatgcatataataattcttatt |
332 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2757655 |
ccttctctagttaacaatgcatataataattcttatt |
2757691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University