View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1272_low_43 (Length: 388)
Name: NF1272_low_43
Description: NF1272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1272_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 1e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 29 - 169
Target Start/End: Original strand, 56377409 - 56377546
Alignment:
| Q |
29 |
attatcctgtcataacataatataataataagcatggaaacttgtatttgatgtatcttcacttcacttcttctccaattcatcaattcttcttctgtat |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || |
|
|
| T |
56377409 |
attatcctgtcataacataatataataataagcatggaaacttgtatttgatgtatcttcacttcacttcttctccaattcatcaa---ttcttctgcat |
56377505 |
T |
 |
| Q |
129 |
gtggctgactacttgattctcaattaattagctaaaccaac |
169 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
56377506 |
gtggctgactacttcattctcaattaattagctaaaccaac |
56377546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 241 - 377
Target Start/End: Original strand, 56377613 - 56377746
Alignment:
| Q |
241 |
gaggagagatataacacccagggtgggaaagtgtcttgtatgcttataaagttgtcttctcatcattaccatatgtttctgcagtagtgcatgccctact |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
56377613 |
gaggagagatataacacccagggtgggaaagtgtcttgtatgcttataaagttgtcttctcatcattaccatatgtttctgc---agtggatgccctact |
56377709 |
T |
 |
| Q |
341 |
aattaattgcttgcttgcaattcttgatccctttcat |
377 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
56377710 |
aattaattacttgcttgcaattcttgatccctttcat |
56377746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University