View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1272_low_47 (Length: 362)
Name: NF1272_low_47
Description: NF1272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1272_low_47 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 3e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 109 - 293
Target Start/End: Complemental strand, 5957250 - 5957075
Alignment:
| Q |
109 |
gttggtgttttgcttctaaattctaaggcagaagaagagtttacgactaaatctaattaaattcacaaaagacttgttaaaaatgtcagtgagtgcttag |
208 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5957250 |
gttggtgttttgcttctaaat-ctgaggcagaagaagagtttacgactaaatctaa----attcacaaaagacttgttaaaaatgtcagtgagtgcttag |
5957156 |
T |
|
| Q |
209 |
tgtccattgaaattcatgatatatatgatgatgcatctacttttcatttcatttgtaatttgcaaccgatgagttggattattta |
293 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5957155 |
tgtccattgaaattcatg----atatgatgatgcatctacttttcatttcatttgtaatttgcaaccgatgagttagattattta |
5957075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University