View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1272_low_52 (Length: 327)
Name: NF1272_low_52
Description: NF1272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1272_low_52 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 86; Significance: 4e-41; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 54 - 151
Target Start/End: Original strand, 25409932 - 25410029
Alignment:
| Q |
54 |
tgtaaatcatgttcttgaaagatgatctgatatttatcatcacattcatcataaactagtagttgtaattagggttggaaaatatgtaagacttaccg |
151 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25409932 |
tgtaaaccatgttattgaaagatgatctgatatttatcatcacattcatcataaactagtagttataattagggttggaaaatatgtaagacttaccg |
25410029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 237 - 303
Target Start/End: Original strand, 25410142 - 25410208
Alignment:
| Q |
237 |
ctttaattaaaaatataaattttaagccgcaaaaaccttttaagcttatcaagacgagctacataag |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
25410142 |
ctttaattaaaaatataaattttaagccgcaaaaaccttttaagcttattaagacgagctacataag |
25410208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University