View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1272_low_54 (Length: 324)
Name: NF1272_low_54
Description: NF1272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1272_low_54 |
 | |
|
| [»] chr8 (6 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 96 - 324
Target Start/End: Original strand, 3678039 - 3678270
Alignment:
| Q |
96 |
agttcacataagattattgatattcacaagataaaagtgaaaa---taacatattttattgattgtgtacaaggtggtgccatctgcaattttagcaata |
192 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3678039 |
agttcacataagactattgatattcacaagataaaagtgaaaaatataacatattttattgattgtgtacaaggtggtgccatctgcaattttagcaata |
3678138 |
T |
|
| Q |
193 |
tttatccacccatttacaagacatgtttggatagccagggttctatgggcgttcaccgtatacgtggaagctatttcaatacttcctcaacttcgttata |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3678139 |
tttatccacccatttacaagacatgtttggatagccagggttctatgggcgttcaccgtatatgtggaagctatttcaatacttcctcaacttcgttata |
3678238 |
T |
|
| Q |
293 |
tgcaaaatgcaaaggtttgcagcctctcaatt |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3678239 |
tgcaaaatgcaaaggtttgcagcctctcaatt |
3678270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 257 - 308
Target Start/End: Original strand, 3662865 - 3662916
Alignment:
| Q |
257 |
tggaagctatttcaatacttcctcaacttcgttatatgcaaaatgcaaaggt |
308 |
Q |
| |
|
||||| |||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3662865 |
tggaaactatttcaattcttccccaacttcgttatatgcaaaatgcaaaggt |
3662916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 257 - 310
Target Start/End: Original strand, 3685729 - 3685782
Alignment:
| Q |
257 |
tggaagctatttcaatacttcctcaacttcgttatatgcaaaatgcaaaggttt |
310 |
Q |
| |
|
||||| || ||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3685729 |
tggaaactgtttcagtacttcctcaaattcgttatatgcaaaatgcaaaggttt |
3685782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 135 - 185
Target Start/End: Original strand, 3685606 - 3685657
Alignment:
| Q |
135 |
aaaataacat-attttattgattgtgtacaaggtggtgccatctgcaatttt |
185 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
3685606 |
aaaataacattattttattgattgtgtactaggtggtgccttctgcaatttt |
3685657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 135 - 192
Target Start/End: Original strand, 3669060 - 3669117
Alignment:
| Q |
135 |
aaaataacatattttattgattgtgtacaaggtggtgccatctgcaattttagcaata |
192 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| | | ||||||||||| |||||| |
|
|
| T |
3669060 |
aaaataacatattctattgattgtgtacaaggtgatagcttctgcaattttggcaata |
3669117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 134 - 167
Target Start/End: Original strand, 3662739 - 3662772
Alignment:
| Q |
134 |
gaaaataacatattttattgattgtgtacaaggt |
167 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
3662739 |
gaaaataacagattttattgattgtgtacaaggt |
3662772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University