View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1272_low_58 (Length: 310)
Name: NF1272_low_58
Description: NF1272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1272_low_58 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 98 - 227
Target Start/End: Complemental strand, 6359014 - 6358885
Alignment:
| Q |
98 |
acaagttatagtcagaaatgttaaatgatattgttactagaagaaggattagaagcttcttttgaaagtgattttattccggttgaaatttgctttatct |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6359014 |
acaagttatagtcagaaatgttaaatgatattgttactagaagaaggattagaagcttcttttgaaagtgattttattccggttgaaatttgctttatct |
6358915 |
T |
 |
| Q |
198 |
gttccttgtacctaactaacccatattctt |
227 |
Q |
| |
|
|||||||||||||||||||||| |||||| |
|
|
| T |
6358914 |
attccttgtacctaactaacccacattctt |
6358885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 98 - 227
Target Start/End: Original strand, 32857478 - 32857607
Alignment:
| Q |
98 |
acaagttatagtcagaaatgttaaatgatattgttactagaagaaggattagaagcttcttttgaaagtgattttattccggttgaaatttgctttatct |
197 |
Q |
| |
|
||||||| ||||||||||||||||| |||| || | | |||||||| ||||||||||||| | | || |||||||| | |||| |||||||||||||| |
|
|
| T |
32857478 |
acaagttctagtcagaaatgttaaaggatactgccattggaagaaggcttagaagcttcttctaatagaaattttatttcagttgcaatttgctttatct |
32857577 |
T |
 |
| Q |
198 |
gttccttgtacctaactaacccatattctt |
227 |
Q |
| |
|
|||||||| |||||||||||| |||||| |
|
|
| T |
32857578 |
cttccttgtctctaactaacccacattctt |
32857607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University