View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1272_low_59 (Length: 308)
Name: NF1272_low_59
Description: NF1272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1272_low_59 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 30 - 298
Target Start/End: Complemental strand, 26309684 - 26309419
Alignment:
| Q |
30 |
cttttttattgatggtatcaatcaatctcattgatttgtttttggagaattattaccttccttgtatgtacttcaactactagtttataactccctcttt |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26309684 |
cttttttattgatggtatcaatcaatctcattgatttgtttttggagaattattaccttccttgtatatacttcaactactagtttataactccctcttt |
26309585 |
T |
|
| Q |
130 |
ttctgatgaaaattgcactatgatgttgggtgggaaggacaaaagggataagacaaaacttgtttgttagagatccaattgcaatagaattacctcaaag |
229 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26309584 |
ttctgatgaatattgcactatgatgttgggtgagaaggacaaaagggataagacaaaacttgtttgttagagatccaattgcaatagaattacctcaaag |
26309485 |
T |
|
| Q |
230 |
ccatcatccacacaatacaaaggaggatctcgacatcatgaacaggtcaatttaattatcaaccctatg |
298 |
Q |
| |
|
| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26309484 |
c---catccacacgatacaaaggaggatctcgacatcatgaacaggtcaatttaattatcaaccctatg |
26309419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University