View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1272_low_63 (Length: 302)
Name: NF1272_low_63
Description: NF1272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1272_low_63 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 256; Significance: 1e-142; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 273
Target Start/End: Complemental strand, 54080945 - 54080671
Alignment:
| Q |
1 |
tatgcagtgtatttgttgttgatactctgaagaggttttgaagtat--ttatagctgctgaatgctcttgttttggtgtgaacatgtggaatgattattt |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
54080945 |
tatgcagtgtatttgttgttgatactctgaagaggttttgaagtatatttatagccgctgaatgctctagttttggtgtgaacatgtggaatgattattt |
54080846 |
T |
|
| Q |
99 |
taagtttgaggctagaaagtgggggaaatcatatttgcgtggcatatttggatttggatgaacaaaaacttgtggttgaagccccttgaacatgcacatt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54080845 |
taagtttgaggctagaaagtgggggaaatcatatttgcgtggcatatttggatttggatgaacaaaaacttgtggttgaagccccttgaacatgcacatt |
54080746 |
T |
|
| Q |
199 |
cgcatgatttatgacatgttccaatacaatatgtcgactcatatgatggccactaaccatagtggaggatgaaag |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54080745 |
cgcatgatttatgacatgttccaatacaatatgtcgactcatatgatggccactaaccatagtggaggatgaaag |
54080671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 71 - 273
Target Start/End: Complemental strand, 54084228 - 54084028
Alignment:
| Q |
71 |
ttggtgtgaacatgtggaatgattattttaagtttgaggctagaaagtgggggaaatcatatttgcgtggcatatttggatttggatgaacaaaaacttg |
170 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||||| | ||| |||||||| |||||||||||||| ||||||||| | ||||||||| |
|
|
| T |
54084228 |
ttggtgtgaaaatgcggaatgattattttaagtttgaggctagaaagtagaggagatcatattggcgtggcatatttgaatttggatggataaaaacttg |
54084129 |
T |
|
| Q |
171 |
tggttgaagccccttgaacatgcacattcgcatgatttatgacatgttccaatacaatatgtcgactcatatgatggccactaaccatagtggaggatga |
270 |
Q |
| |
|
|||||||| | |||||||| ||| |||| |||||||||||| ||||| |||||||| ||| ||||||||| |||||||||| | ||||||||||||| |
|
|
| T |
54084128 |
tggttgaaacgccttgaacttgctcattggcatgatttatggcatgtgccaataca--atgccgactcatacgatggccactctacttagtggaggatga |
54084031 |
T |
|
| Q |
271 |
aag |
273 |
Q |
| |
|
||| |
|
|
| T |
54084030 |
aag |
54084028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University