View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1272_low_66 (Length: 294)
Name: NF1272_low_66
Description: NF1272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1272_low_66 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 30 - 285
Target Start/End: Original strand, 52676949 - 52677204
Alignment:
| Q |
30 |
ctagagagcaacaagctttgctggaattggaagatactggtgcaagattgatgagggaaaaggaaactttgaaaaacacgcttaattatctatctgctgc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52676949 |
ctagagagcaacaagctttgctggaattggaagatactggtgcaagattgatgagggaaaaggaaactttgaaaaatacgcttaattatctatctgctgc |
52677048 |
T |
|
| Q |
130 |
ttctgccgttaaagatgtttttccatcttcatcttctccttcctcaccatcatcatgatcaattcaatagagatgcaaagagtttagttcaaatacatga |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52677049 |
ttctgccgttaaagatgtttttccatcttcatcttctccttcctcaccatcatcatgatcaattcaatagagatgcaaagagtttagttcaaatacatga |
52677148 |
T |
|
| Q |
230 |
aaggtattgtttgcatcgataatagggaaaaacttgtaaattctcctaagtataat |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52677149 |
aaggtattgtttgcatcgataatagggaaaaacttgtaaattctcctaagtataat |
52677204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University