View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1272_low_67 (Length: 286)
Name: NF1272_low_67
Description: NF1272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1272_low_67 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 28 - 139
Target Start/End: Complemental strand, 7003941 - 7003830
Alignment:
| Q |
28 |
catgaggtacatctcttgtccattctccttaaaaaatgagtaatttattacttttataattgagatttgacatcaattttattttcaacgagtacaaaaa |
127 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7003941 |
catgaggtacatctcttgtccatcctccttaaaaaatgagtaatttattacttttataattgagatttgacatcaattttattttcaacgagtacaaaaa |
7003842 |
T |
 |
| Q |
128 |
catgcttgtgtt |
139 |
Q |
| |
|
|||||||||||| |
|
|
| T |
7003841 |
catgcttgtgtt |
7003830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 135 - 276
Target Start/End: Complemental strand, 7003675 - 7003543
Alignment:
| Q |
135 |
gtgtttgagtcttttatcacgcagatgaaccatataacaattcactacttttctttacaatctttacaaataatgtattttggatggttacttcatgata |
234 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7003675 |
gtgtttgaatcttttatcacgcagatagaccatataacaattcactgcttttctttacaa---------ataatgtattttggatggttacttcatgata |
7003585 |
T |
 |
| Q |
235 |
tgatgttagagctgattagatggcatattgtttaatcctttg |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7003584 |
tgatgttagagctgattagatggcatattgtttaatcctttg |
7003543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University