View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1272_low_81 (Length: 255)
Name: NF1272_low_81
Description: NF1272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1272_low_81 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 11 - 200
Target Start/End: Original strand, 6358303 - 6358491
Alignment:
| Q |
11 |
cagagatcaatattaaagagattgcagannnnnnnnccaaaggtttatgcttcaaaacataaattagttgataatgatatggggattacagaccactcac |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6358303 |
cagaaatcaatattaaagagattgcagattttttt-ccaaaggtttatgcttcaaaacataaattagttgataatgatatggggattacagaccactcac |
6358401 |
T |
|
| Q |
111 |
aaggttaagcttatggggatttacacattttgttttagatacggttatgatgtttttgtggatttgactctctcgtaatgtatctctgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6358402 |
aaggttaagcttatggggatttacacattttgttttagatacggttatgatgtttttgtggatttgactctctcgtaatgtatctctgaa |
6358491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 206 - 255
Target Start/End: Original strand, 6358531 - 6358580
Alignment:
| Q |
206 |
ataccatttgtgacgtcttattatcccatttctttgttatttttctaatc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6358531 |
ataccatttgtgacgtcttattatcccatttctttgttatttttctaatc |
6358580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University