View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1272_low_84 (Length: 252)
Name: NF1272_low_84
Description: NF1272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1272_low_84 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 45362746 - 45362982
Alignment:
| Q |
1 |
tcccgtacgtgcaatccatatcataattccactacactttttaaagaaaaagtatatgattattggcgttatccaaagtctnnnnnnnnnntctcactct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45362746 |
tcccgtacgtgcaatccatatcataattccactacactttttaaagaaaaagtatatgattattggcgttatccaaagtctaaaaaaaaaatctcactct |
45362845 |
T |
|
| Q |
101 |
tataatataatgtcattagtttttaactagagtaacaatcagcagaggtgaggaaaggatgacaacgacaagggaatattgagggccgttacccccaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45362846 |
tataatataatgtcattagtttttaactagagtaacaatcagcagaggtgaggaaaggatgacaacgacaagggaatattgagggccgttacccccaaat |
45362945 |
T |
|
| Q |
201 |
gccacccctctgcagccaaatgcactttctatgctag |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45362946 |
gccacccctctgcagccaaatgcactttctatgctag |
45362982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University