View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1272_low_98 (Length: 209)
Name: NF1272_low_98
Description: NF1272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1272_low_98 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 41 - 201
Target Start/End: Complemental strand, 54731586 - 54731431
Alignment:
| Q |
41 |
acataatacaactagttgtattgtattaacctggcagtagcttattggagtgcatgacagttggtcaatatagaaaccacaaagatttgcaacccattcc |
140 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54731586 |
acataatacaactagttg-----tattaacctggcagtagcttattggagtgcatgacagttggtcaatatagaaaccacaaagatttgcaacccattcc |
54731492 |
T |
 |
| Q |
141 |
ttactctataagaaaaatatgccacccactctctttgcttaattgctttctccttcatctc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54731491 |
ttactctataagaaaaatatgccacccactctctttgcttaattgctttctccttcatctc |
54731431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 41 - 201
Target Start/End: Complemental strand, 5305666 - 5305511
Alignment:
| Q |
41 |
acataatacaactagttgtattgtattaacctggcagtagcttattggagtgcatgacagttggtcaatatagaaaccacaaagatttgcaacccattcc |
140 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5305666 |
acataatacaactagttg-----tattaacctggcagtagcttattggagtccatgacagttggtcaatatagaaaccacaaagatttgcaacccattcc |
5305572 |
T |
 |
| Q |
141 |
ttactctataagaaaaatatgccacccactctctttgcttaattgctttctccttcatctc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5305571 |
ttactctataagaaaaatatgccacccactctctttgcttaattgctttctccttcatctc |
5305511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University