View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1273-Insertion-10 (Length: 450)
Name: NF1273-Insertion-10
Description: NF1273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1273-Insertion-10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 6e-81; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 6e-81
Query Start/End: Original strand, 11 - 194
Target Start/End: Original strand, 14225451 - 14225635
Alignment:
| Q |
11 |
gattagatgaagggtcagctgtttgccgagttatctctagcacgaccaccacatcactcttaaacctctcactattcgagctgtttgactgtgctggttt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
14225451 |
gattagatgaagggtcagctgtttgccgagttatctctagcacgaccaccacatcactcttaaacctctcaccattcgagctgtttgaccgtgctggttt |
14225550 |
T |
|
| Q |
111 |
a-ttttttatcataacctgatacgtatcataagatttggattttcaagagcattgcataccaaaattcaaacttgtaatcaagta |
194 |
Q |
| |
|
| |||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14225551 |
atttttttatgataacctgataagtatcataagatttggaatttcaagagcattgcataccaaaattcaaatttgtaatcaagta |
14225635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 389 - 433
Target Start/End: Original strand, 14225739 - 14225783
Alignment:
| Q |
389 |
ttgacaatgttataaactttcaagaataaaatccaaatgttcatt |
433 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||| |||||||| |
|
|
| T |
14225739 |
ttgacaatgttctaaactttcaagaatgaaatccaactgttcatt |
14225783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University