View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1273-Insertion-13 (Length: 122)
Name: NF1273-Insertion-13
Description: NF1273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1273-Insertion-13 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 52; Significance: 3e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 3e-21
Query Start/End: Original strand, 7 - 122
Target Start/End: Original strand, 9235301 - 9235417
Alignment:
| Q |
7 |
acaacccaattgtatgttgtggtagatatgtatacatagtcttgcttcgga-nnnnnnngcattctttctgctctttagggtttccttgtagagcacttt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| ||| ||| ||||||||||||| |||| ||| |
|
|
| T |
9235301 |
acaacccaattgtatgttgtggtagatatgtatacatagtcatgcttcggattttttttgcattctttgtgcccttgtgggtttccttgtaaagcatttt |
9235400 |
T |
|
| Q |
106 |
gtgtcatttttcagtat |
122 |
Q |
| |
|
|||| ||||||| |||| |
|
|
| T |
9235401 |
gtgtaatttttcggtat |
9235417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University