View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1273-Insertion-2 (Length: 177)
Name: NF1273-Insertion-2
Description: NF1273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1273-Insertion-2 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 8e-66; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 8e-66
Query Start/End: Original strand, 8 - 177
Target Start/End: Complemental strand, 45108166 - 45107991
Alignment:
| Q |
8 |
tttctaaaccctcgtttataattatatcgacaatgctatacaccgtgaatgttccattcatgaaataaggtctttaaattgaattcggatgaattaaggt |
107 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45108166 |
tttctaaaccctcatttataattatatcgacaatgctatacaccatgaatgttccattcatgaaataaggtctttaaattgaattcggatgaattaaggt |
45108067 |
T |
|
| Q |
108 |
aattgtaatcaatt--ttgtg---tg-gttattatttgtgtgtaggctgggctaattttaggaccagcagtgccaa |
177 |
Q |
| |
|
|||||||||||||| ||||| || ||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45108066 |
aattgtaatcaattgattgtgcattgtgttgttatttttgtgtaggctgggctaattttaggaccagcagtgccaa |
45107991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University