View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1273-Insertion-8 (Length: 227)
Name: NF1273-Insertion-8
Description: NF1273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1273-Insertion-8 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 123 - 227
Target Start/End: Complemental strand, 54898065 - 54897961
Alignment:
| Q |
123 |
aggcacgttccaagagatggatgcacgcaagacgaaagaaacggagaatgtcacaaaagagagaagtaaaccatatgtgggacaccacatactctcagca |
222 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54898065 |
aggcacgtcccaagagatggatgcacacaagacgaaagaaacggagaatgtcacaaaagagagaagtaaaccatatgtgggacaccacatactctcagca |
54897966 |
T |
|
| Q |
223 |
acaag |
227 |
Q |
| |
|
||||| |
|
|
| T |
54897965 |
acaag |
54897961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 22 - 108
Target Start/End: Complemental strand, 54898436 - 54898350
Alignment:
| Q |
22 |
aaaaacaagcctaaggctggtagaacttggcaggttaatgttttattcgtgttacatgtttttagcgccactaaccgaaacaattac |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
54898436 |
aaaaacaagcctaaggctggtagaacttggcaggttaatgttttattcgtgttgcatgtttttagcgccactaaccgaaacaattac |
54898350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University