View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1273-Insertion-9 (Length: 110)
Name: NF1273-Insertion-9
Description: NF1273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1273-Insertion-9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 8e-43; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 8e-43
Query Start/End: Original strand, 11 - 102
Target Start/End: Complemental strand, 26463498 - 26463407
Alignment:
| Q |
11 |
caaaccatgagcaagcaagttgccagtggcactttgtctaatgtgaacaacctaagcactacttttttcagagttcatatttaaatctagtt |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26463498 |
caaaccatgagcaagcaagttgccagtggcactttctctaatgtgaacaacctaagcactacttttttcagagttcatatttaaatctagtt |
26463407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.000000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000002
Query Start/End: Original strand, 33 - 102
Target Start/End: Complemental strand, 14367777 - 14367708
Alignment:
| Q |
33 |
ccagtggcactttgtctaatgtgaacaacctaagcactacttttttcagagttcatatttaaatctagtt |
102 |
Q |
| |
|
|||||| ||||| |||| ||||||||||||| ||||||||| |||| |||||||||||||||| |||||| |
|
|
| T |
14367777 |
ccagtgccacttcgtctcatgtgaacaacctcagcactactattttgagagttcatatttaaacctagtt |
14367708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University