View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12730_high_8 (Length: 222)
Name: NF12730_high_8
Description: NF12730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12730_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 212
Target Start/End: Complemental strand, 22588931 - 22588737
Alignment:
| Q |
18 |
ccttcatttatcttgccctaggcatttcataatggagatatatttttcttgtgtgtgtgtttttgggaactgaaaatgaattattttctatcttgaaatc |
117 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22588931 |
ccttcatttatcttgccctagacatttcataatggagatatatttttcttgtgtgtgtgtttttgggaactgaaaatgaatgattttctatcttgaaatc |
22588832 |
T |
 |
| Q |
118 |
actttgttatggatctattgacttggtttactacccaattggtttttgggctggccggtatatttggctctgcagtgtttatggggttttctctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22588831 |
actttgttatggatctattgacttggtttactacccaattggtttttgggctggccggtatatttggctctgcagtgtttatggggttttctctg |
22588737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 94; Significance: 5e-46; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 18 - 131
Target Start/End: Original strand, 30936732 - 30936845
Alignment:
| Q |
18 |
ccttcatttatcttgccctaggcatttcataatggagatatatttttcttgtgtgtgtgtttttgggaactgaaaatgaattattttctatcttgaaatc |
117 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
30936732 |
ccttcatttatcttgccctggacatttcataatggagctatatttttcttgtgtgtgtgtttttgggaactgaaaatgtattgttttctatcttgaaatc |
30936831 |
T |
 |
| Q |
118 |
actttgttatggat |
131 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
30936832 |
actttgttatggat |
30936845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 18 - 106
Target Start/End: Original strand, 18365837 - 18365925
Alignment:
| Q |
18 |
ccttcatttatcttgccctaggcatttcataatggagatatatttttcttgtgtgtgtgtttttgggaactgaaaatgaattattttct |
106 |
Q |
| |
|
||||| ||||||||||||| | ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
18365837 |
ccttcgtttatcttgccctggacatttcataatggagctatatttttcttgtgtgtgtgtttttgggaactgaaaatgaattgttttct |
18365925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 143 - 212
Target Start/End: Complemental strand, 18366015 - 18365946
Alignment:
| Q |
143 |
gtttactacccaattggtttttgggctggccggtatatttggctctgcagtgtttatggggttttctctg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18366015 |
gtttactacccaattggtttttgggctggccggtatttttggctctgcagtgtttatggggttttctctg |
18365946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 149 - 212
Target Start/End: Original strand, 30936845 - 30936908
Alignment:
| Q |
149 |
tacccaattggtttttgggctggccggtatatttggctctgcagtgtttatggggttttctctg |
212 |
Q |
| |
|
|||||| |||||||||||||||| |||||| || ||||||||| |||||||||| ||||||||| |
|
|
| T |
30936845 |
tacccagttggtttttgggctggtcggtattttgggctctgcaatgtttatgggattttctctg |
30936908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University