View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12730_low_6 (Length: 250)
Name: NF12730_low_6
Description: NF12730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12730_low_6 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 13 - 250
Target Start/End: Original strand, 9126314 - 9126551
Alignment:
| Q |
13 |
tggacatcatttcctcaatcataacacttcaatgtggataagaggcgagactttacattcctattcatgtcgagttaaatcatcatccctttcattcttt |
112 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9126314 |
tggacatcattttctcaatcataacacttcaatgtggataagaggcgagactttacattcctattcatgtcgagttaaatcatcatccatttcattcttt |
9126413 |
T |
|
| Q |
113 |
ctttcacgctttgactttctcgaccaacaataagtctttcagggaaaataggctaatcctcggtatttgtctcactgctcctttgcctcatccaacccct |
212 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
9126414 |
ctttcacactttgactttctcgaccaacaataagtctttcagggaaaacaggctaatcctcggtatctgtctcactgctcctttgcctcatccaaaccct |
9126513 |
T |
|
| Q |
213 |
agtgaagatgtattatcattatgaggttttctcttcat |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9126514 |
agtgaagatgtattatcattatgaggttttctcttcat |
9126551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University