View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12730_low_7 (Length: 249)
Name: NF12730_low_7
Description: NF12730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12730_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 6e-89; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 14 - 203
Target Start/End: Complemental strand, 9127005 - 9126816
Alignment:
| Q |
14 |
agacgagtgacaaagactctgatgactttgacagaagatatattttattagacaaatgaaatattagttgtcttttgttttcttgaagagctgttagtga |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9127005 |
agacgagtgacaaagactctgatgactttgacaaaagatatattttattagacaaatgaaatattagttgtcttttgttttcttgaagatctgttagtga |
9126906 |
T |
 |
| Q |
114 |
tttccttttgtatttagattgaaatatatttacatattaatcaaaggggcgactatttgttcatcatgcatgtgggaccaagttttcata |
203 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9126905 |
tttccttttgtatttagattgaaatctattcacatattaatcaaaggggcgaccatttgatcatcatgcatgtgggaccaagttttcata |
9126816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 212 - 249
Target Start/End: Complemental strand, 9126788 - 9126751
Alignment:
| Q |
212 |
gtaactatataaacttttctatctacactggctcacct |
249 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9126788 |
gtaactatataaacttttctatctacattggctcacct |
9126751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University