View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12730_low_8 (Length: 239)
Name: NF12730_low_8
Description: NF12730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12730_low_8 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 17 - 239
Target Start/End: Original strand, 4853001 - 4853223
Alignment:
| Q |
17 |
aagaaaatcctactaaatgtgtatatattcatgcaaagaataaaggagtgcgaaacactgaaaagaaacaccgatatgataatctttgtatggtccagta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4853001 |
aagaaaatcctactaaatgtgtatatattcatgcaaagaataaaggagtgcgaaacactgaaaagaaacaccgatatgataatctttgtatggtccagta |
4853100 |
T |
|
| Q |
117 |
cttgatatatgtccctttttgcattatggttattgaagttttgacactgtcttttacgtttctcgtacatatgaatgctgattttggcctttttatgatg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4853101 |
cttgatatatgtccctttttgcattatggttattgaagttttgacactgtcttttacgtttctcgtacatatgaatgctgattttggcctttttatgatg |
4853200 |
T |
|
| Q |
217 |
agcctattcatgttctatgaaat |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
4853201 |
agcctattcatgttctatgaaat |
4853223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University