View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12731_low_11 (Length: 246)
Name: NF12731_low_11
Description: NF12731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12731_low_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 34500084 - 34500326
Alignment:
| Q |
1 |
tttcaaaaacactccttttgattcggtccaaattgcgcaatctgcagtgttgttggttaatgagtttaacttggcaaacaggaaagtggaatgtcaccgc |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34500084 |
tttcaaaaacactccttttgatccggtccaaattgcgcagtctgcagtgttgttggttgatgagtttaacttggcaaacaggaaagtggaatgtcagcgc |
34500183 |
T |
 |
| Q |
101 |
gtaacccctgcaccctctcggtggtgtcctcctccggatggaactatcaagattaatgtcgacgtagggtgcttcaaagatggcagcatggggtggggtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34500184 |
gtaacccctgcaccctctcggtggtgtcctcctccggatggaactatcaagattaatgtcgacgcagggtgcttcaaagatggcagcatggggtggggtt |
34500283 |
T |
 |
| Q |
201 |
ttgctgttagaaaccatcagggaggggtgttgttctctgctac |
243 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34500284 |
ttgctgctagaaaccatcagggaggggtgttgttctctgctac |
34500326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University