View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12732_high_2 (Length: 391)
Name: NF12732_high_2
Description: NF12732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12732_high_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 139; Significance: 1e-72; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 18 - 156
Target Start/End: Original strand, 31013103 - 31013241
Alignment:
| Q |
18 |
gttttctatctctttatctcataacaaataaagtaggtttttgcggtaatcgtaacggtcgtgttgcaatgtttaatattgtagagaattataatcaaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31013103 |
gttttctatctctttatctcataacaaataaagtaggtttttgcggtaatcgtaacggtcgtgttgcaatgtttaatattgtagagaattataatcaaat |
31013202 |
T |
 |
| Q |
118 |
gtgactgatatggtctcattgacatacccgaacgaaaga |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31013203 |
gtgactgatatggtctcattgacatacccgaacgaaaga |
31013241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 201 - 355
Target Start/End: Original strand, 31013241 - 31013396
Alignment:
| Q |
201 |
aatgcgactgatatagcctcatcgacagttagattgtgcatgagcctttatttaaaatccttcttaagaatttgtagttttgagtttctatttctatttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31013241 |
aatgcgactgatatagcctcatcgacagttagattgtgcatgagcctttatttaaaatccttcttaagaatttgtagttttgagtttctatttctatttt |
31013340 |
T |
 |
| Q |
301 |
tggctttcctaatttggtgccaa-nnnnnnncccaattcctcctgcaactcctatg |
355 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31013341 |
tggctttcctaatttggtgccaattttttttcccaattcctcctgcaactcctatg |
31013396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 80 - 132
Target Start/End: Original strand, 31002482 - 31002534
Alignment:
| Q |
80 |
gttgcaatgtttaatattgtagagaattataatcaaatgtgactgatatggtc |
132 |
Q |
| |
|
|||||||| |||||||||||||||||| | || |||||||||||||| ||||| |
|
|
| T |
31002482 |
gttgcaatttttaatattgtagagaatcacaaacaaatgtgactgatgtggtc |
31002534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University