View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12732_high_5 (Length: 245)
Name: NF12732_high_5
Description: NF12732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12732_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 19 - 234
Target Start/End: Original strand, 39440242 - 39440458
Alignment:
| Q |
19 |
ggtataccattatattttttcaa-gtagacttactatattgtgctgattagccatagaaatactcacaatctgcacggttgatttgctctcattttattt |
117 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39440242 |
ggtataccattatattttttcaaagtagacttactatattgtgctgattagccatagaaatactcacaatctgcacggtttatttgctctcattttattt |
39440341 |
T |
 |
| Q |
118 |
tagtgactgattgatagttaaagacttctaataattacttattagcatagtaatggataaaaagtatgcctatacatataatgaagttctaattctttct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39440342 |
tagtgactgattgatagttaaagacttctaataattacttattagcatagtaatggataaaaagtatgcctatacatataatgaagttctaattctttct |
39440441 |
T |
 |
| Q |
218 |
ctgtttcttgaggtctg |
234 |
Q |
| |
|
||||||||||| ||||| |
|
|
| T |
39440442 |
ctgtttcttgaagtctg |
39440458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University