View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12732_high_6 (Length: 239)
Name: NF12732_high_6
Description: NF12732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12732_high_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 126 - 238
Target Start/End: Original strand, 491943 - 492051
Alignment:
| Q |
126 |
aacattcattccttcattgcattataagaatctttgacatgctctctctaggcttcatcactgttgagttttttctgatccagatgtgctcaattggctt |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
491943 |
aacatacattccttcattgcattataagaatctttgacatgctct----aggcttcatcactgttgagttttttctgatccagatgtgctcaattggctt |
492038 |
T |
 |
| Q |
226 |
aaacacaaactaa |
238 |
Q |
| |
|
||||||||||||| |
|
|
| T |
492039 |
aaacacaaactaa |
492051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University