View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12733_high_9 (Length: 299)
Name: NF12733_high_9
Description: NF12733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12733_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 31 - 245
Target Start/End: Original strand, 6267117 - 6267330
Alignment:
| Q |
31 |
catcatgagtaccatttccttcattcaactatagagatatgggggaatagattaatctgtcacaannnnnnnatttgcagcaagcatcttttgcagaatt |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6267117 |
catcatgagtaccatttccttcattcaactatagagatatgggggaatagattaatctgtcacaatttttttatttgcagcaagcatcttttgcagaatt |
6267216 |
T |
|
| Q |
131 |
ttggtgagttgcagaattttggaatagattaatcagtctcatttttatttataataaatttataccatcaattaaatttaactgtattttttatggttca |
230 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6267217 |
ttggtgagttgcagaattt-ggaacagattaatcagtctcatttttatttataataaatttataccatcaattaaatttaactgtattttttatggttca |
6267315 |
T |
|
| Q |
231 |
ccgataaaaggattt |
245 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
6267316 |
ccaataaaaggattt |
6267330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University