View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12733_low_13 (Length: 255)
Name: NF12733_low_13
Description: NF12733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12733_low_13 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 20 - 255
Target Start/End: Complemental strand, 1611565 - 1611330
Alignment:
| Q |
20 |
gagtcgaagaggtttgttgatctatgtggcaatttcagtaaaatgcacattggtggtagtaatggtaatcaacatcaagagaatgctagtaatgttaatg |
119 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1611565 |
gagtcaaagaggtttgttgatctatgtggcaatttcagtaaaatgcacattggtggtagtaatggcaatcaacatcaagagaatgctagtaatgttaatg |
1611466 |
T |
 |
| Q |
120 |
attttacttttttgaatccaatcaatgttgataattttaataatcatgataagtatgtggattttgatggttataagagaggttttttggattctgatca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
1611465 |
attttacttttttgaatccaatcaatgttgataattttaataatcatgataagtatgtggattttgatggttataagagaggttttttggattctgatta |
1611366 |
T |
 |
| Q |
220 |
tgtggggtttcagtcctctatgttgagaagccctat |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
1611365 |
tgtggggtttcagtcctctatgttgagaagccctat |
1611330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University