View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12733_low_15 (Length: 241)
Name: NF12733_low_15
Description: NF12733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12733_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 11 - 114
Target Start/End: Original strand, 9590105 - 9590222
Alignment:
| Q |
11 |
cataggaaattcgtgaaattgatataatcacttcaatacaaaatttagctcca--------------gattccagccaactttcattagagagactttgt |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
9590105 |
cataggaaattcgtgaaattgatataatcacttcgctacaaaatttagctccatctttaataaaccagattccagccaactttcattagagaaactttgt |
9590204 |
T |
|
| Q |
97 |
taatacatcatctcactg |
114 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
9590205 |
taatacatcatctcactg |
9590222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 114 - 169
Target Start/End: Original strand, 9590252 - 9590307
Alignment:
| Q |
114 |
ggcttgcagagattttgctagtaagtatgcacatgatacacatcatcccaaatgaa |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9590252 |
ggcttgcagagattttgctagtaagtatgcacatgatacacatcatcccaaatgaa |
9590307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University