View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12733_low_16 (Length: 240)

Name: NF12733_low_16
Description: NF12733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12733_low_16
NF12733_low_16
[»] chr2 (1 HSPs)
chr2 (1-224)||(1611066-1611289)


Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 1611289 - 1611066
Alignment:
1 gattacgaagtagctaattcatttggatcagtaggacttgtccgtgggttgcgcttgcgagacattacgtactctcaattgaatggttttggtggttcaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1611289 gattacgaagtagctaattcatttggatcagtaggacttgtccgtgggttgcgcttgcgagacattacgtactctcaattgaatggttttggtggttcaa 1611190  T
101 tggattctccttatcatagaagagagatgatgaatgattactattgtagaggaagtttgacacctgagattgttacaccatccttgagaagaaattcagt 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
1611189 tggattctccttatcatagaagagagatgatgaatgattactattgtagaggaagtttgacacctgagattgttacaccatccttgagaagaaattcagc 1611090  T
201 tgttagcgatacttcacttggaat 224  Q
    |||||||||| |||||||||||||    
1611089 tgttagcgatgcttcacttggaat 1611066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University