View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12734_high_10 (Length: 231)
Name: NF12734_high_10
Description: NF12734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12734_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 12 - 214
Target Start/End: Complemental strand, 30106797 - 30106594
Alignment:
| Q |
12 |
aacctgtgtggataactattgggatttgagagtcaaggactactaattacattgggg-tagcaaaaaaggagtatcaatccggtgtttcagaaggacgcg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30106797 |
aacctgtgtggataactattgggatttgagagtcaaggactactaattacgttgggggtagcaaaaaaggagtatcaatccggtgattcagaaggacgcg |
30106698 |
T |
 |
| Q |
111 |
gattctatttgtaaggaaaataaattgctttcctctttggactcttggtctgttgattcattaattccgtgcccaaatgattcttcatcacttgatgaag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30106697 |
gattctatttgtaaggaaaataaattgctttcctctttggactcttggtctgttgattcattaattccgtgcccaaatgattcttcatcacttgatgaag |
30106598 |
T |
 |
| Q |
211 |
aatc |
214 |
Q |
| |
|
|||| |
|
|
| T |
30106597 |
aatc |
30106594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University